circad | circRNAs associated with diseases

hsa_circRBM23
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	29916745
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Eleven specimens of histopathologically confirmed HCC tissue and 11 specimens of adjacent normal liver tissue
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TATCCTAGCAATACCACCAGCA Reverse CATGGCCTCAATCACTATGTC	Statistics	Fold Change : Upregulated pvalue : p< 0.01
Citation
Wang, B, Chen, H, Zhang, C, Yang, T, Zhao, Q, Yan, Y, Zhang, Y, Xu, F (2018). Effects of hsa_circRBM23 on Hepatocellular Carcinoma Cell Viability and Migration as Produced by Regulating miR-138 Expression. Cancer Biother. Radiopharm., 33, 5:194-202.